Öğretmen Diyarı Öğretmen Diyarı

Bilimde son nokta!

Bilimsel gelişmeler ışığında artık her türlü bilgiye DNA aracılığıyla ulaşılıyor. Peki, ölüleri konuşturan bu DNA şifresi nasıl çalışıyor. İşte cevabı...
Turgut Özal Üniversitesi'nden Doç. Dr. Kadir Demircan DNA hakkında bilinmeleri anlattı.

DNA, adli ve kriminal olayların çözümünde bir numaralı anahtar vazifesi görüyor. Ölüleri bile konuşturmayı, dilinden anlayanlara derdini anlattırmayı başaran DNA'nın nasıl şifrelendiğini ve insan hayatındaki yerini Doç. Dr. Kadir Demircan anlattı.
Ülkehaber'den İlkay Yaprak'a konuşan Doç. Dr. Kadir Demircan DNA'nın ana yapısını anlatttı. Demircan, bu çalışmaları 'Ölüler konuşamaz ama sır da saklamazlar' sözleriyle değerlendirdi.

İşte Demircan'ın sözleri:

DNA’yı notalara benzetirsek herkeste bu notaların yorumlanması farklıdır. DNA, hücrelerimizin çekirdeğinde yerleşik kimyasal bir molekül. 4 harften oluşan bir şifreyi içeriyor. A, T, C ve G. Sizde AATTTTGGGGCTATCGGGGGGGGAATTTTTTCTC diye bende AATTTTGGGGCTATCGGGGGGGGAATTTTTTAAA şeklinde.

Bende sadece son üç harf farklı. İnsanda bu harf sayısı 3 milyardan fazla. Bu farklılıklar bireysel farklarımızı ortaya çıkarıyor. İnsanlarda bu dizilim benzerliği yüzde 90 dan fazla. Aynı notalarla yazılmış güfteleriz. Ama iş icra ve seslendirmeye gelince sorunuzun cevabı orda saklı. Bu şifreleri deşifre edersek diyor ki bu kişinin saç rengi siyah, onun ki sarı, ötekinin ki kumral….


Bu bilgiler kodlanmış durumda. Genlerin yaptığı bunlarla ilgili proteinlerin üretimi. Ama farklı renk ve tondaki kişiler evlenince bunların karışımı ortaya çıkıyor. Orda hangi notanın icrası güçlüyse çocukda o baskın oluyor. Sonuçta bu kombinasyonlar trilyonlarca oluyor. 7 milyar insanın hiçbiri birbirine benzemiyor.

Genler; yüz hatlarımızı, saç/deri/göz rengimizi, alkole dayanıklılığımızı, parmak izlerimizi, kan gruplarımızı yani bizi biz yapan vücudumuzdaki binlerce proteinin üretilmesini sağlayan şifreleri üzerinde barındırıyorlar. 

Adli bilimlerde ise gizemleri ortadan kaldıran bir yardımcı haline dönüşüyor DNA. Suçlunun olay yerine bıraktığı kan, tükrük, saç ve eşyaları onu ele veriyor. Çünkü DNA onun adına konuşuyor. Ölüler konuşamaz ama sır da saklamazlar. Medyaya yansımayan yaşanmış nice detektif hikayeleri vardır.


Ölüler konuşmuyor ama onların vücudundaki DNA molekülü onlar adına konuşuyor. Babalığın belirlenmesi için eskiden baba ve çocuk çok sayıda kişinin önüne oturuyor, el ayak ve yüzüne bakılarak benziyorsa baba olabilir deniliyordu. 1900 yılında kan grupları babalık davasında kullanılmaya başlandı.


1985 yılından sonra ise genetik belirteçler devreye girdi. DNA, sessiz ama güçlü bir tanıktır. Silent Witness. Mandelanın rakibi olan ve G. Afrikada görülen Botha davasında olduğu gibi 300 yıl önceki bir olayı aydınlatabilir. Nobel ödüllü James Watson, Afrikalıların değersiz ve düşük bir ırk olduğunu söyledi.


Ama onun DNA’sı kendisinin köklerinin Afrika’dan geldiğini gösterince sesi kesildi! Artık elimizde X kromozomu, Y kromozomu ve mitokondri DNA’sı gibi ölüleri konuşturan, davaları aydınlatan çok güçlü sessiz genetik tanıklarımız var. Biz yalan veya çelişkili konuşsak bile DNA’mız gerçekleri haykırıyor.



Anahtar Kelimeler:
bilimde son nokta


Yorum yapabilmek için üye girşi yapmanız gerekmektedir. Üye değilseniz hemen üye olun.

Üye Girişi Üye Ol